Review





Similar Products

spike in template f  (Sangon Biotech)
86
Sangon Biotech spike in template f
Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
Spike In Template F, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/spike in template f/product/Sangon Biotech
Average 86 stars, based on 1 article reviews
spike in template f - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier
hdr dna template sequence  (Twist Bioscience)
86
Twist Bioscience hdr dna template sequence
Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
Hdr Dna Template Sequence, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/hdr dna template sequence/product/Twist Bioscience
Average 86 stars, based on 1 article reviews
hdr dna template sequence - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier
dna template  (Twist Bioscience)
86
Twist Bioscience dna template
Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
Dna Template, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dna template/product/Twist Bioscience
Average 86 stars, based on 1 article reviews
dna template - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier
spike in template r  (Sangon Biotech)
86
Sangon Biotech spike in template r
Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
Spike In Template R, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/spike in template r/product/Sangon Biotech
Average 86 stars, based on 1 article reviews
spike in template r - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier
template dna polynucleotides  (Solexa)
86
Solexa template dna polynucleotides
Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
Template Dna Polynucleotides, supplied by Solexa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/template dna polynucleotides/product/Solexa
Average 86 stars, based on 1 article reviews
template dna polynucleotides - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier
smrtbell template prep kit 1 0  (Pacific Biosciences)
86
Pacific Biosciences smrtbell template prep kit 1 0
Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
Smrtbell Template Prep Kit 1 0, supplied by Pacific Biosciences, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/smrtbell template prep kit 1 0/product/Pacific Biosciences
Average 86 stars, based on 1 article reviews
smrtbell template prep kit 1 0 - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier
pacbio template prep kit 1 0 library preparation process  (Pacific Biosciences)
86
Pacific Biosciences pacbio template prep kit 1 0 library preparation process
Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
Pacbio Template Prep Kit 1 0 Library Preparation Process, supplied by Pacific Biosciences, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pacbio template prep kit 1 0 library preparation process/product/Pacific Biosciences
Average 86 stars, based on 1 article reviews
pacbio template prep kit 1 0 library preparation process - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier
structured csr template  (Novo Nordisk)
86
Novo Nordisk structured csr template
Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
Structured Csr Template, supplied by Novo Nordisk, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/structured csr template/product/Novo Nordisk
Average 86 stars, based on 1 article reviews
structured csr template - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier
smrtbell express template prep kit 2 0  (Pacific Biosciences)
86
Pacific Biosciences smrtbell express template prep kit 2 0
Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
Smrtbell Express Template Prep Kit 2 0, supplied by Pacific Biosciences, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/smrtbell express template prep kit 2 0/product/Pacific Biosciences
Average 86 stars, based on 1 article reviews
smrtbell express template prep kit 2 0 - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier
configuration file template  (Redis Labs)
86
Redis Labs configuration file template
Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
Configuration File Template, supplied by Redis Labs, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/configuration file template/product/Redis Labs
Average 86 stars, based on 1 article reviews
configuration file template - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

Image Search Results


Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel shows spike-in RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.

Journal: STAR Protocols

Article Title: Protocol to produce and apply barcoded rabies virus for single-neuron input mapping in mice

doi: 10.1016/j.xpro.2026.104537

Figure Lengend Snippet: Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel shows spike-in RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.

Article Snippet: Spike-In template F , TAATACGACTCACTATAGGGAGTGAC AATGAAACCTACGTAGTGCAAAGAGA AGTGGCAGTTGCCAAATACAGCAACC TTGGTGGTGGCATGGACGAGCTGTAC AAGTAAGGTACCGGCCAT , Sangon Biotech.

Techniques: Amplification, Purification, Control, In Vitro, Reverse Transcription

Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel shows spike-in RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.

Journal: STAR Protocols

Article Title: Protocol to produce and apply barcoded rabies virus for single-neuron input mapping in mice

doi: 10.1016/j.xpro.2026.104537

Figure Lengend Snippet: Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel shows spike-in RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.

Article Snippet: Spike-In template R , TTTTTTTCTCGACTGAAATGCTTAGAT GACCCAGCCCTCAATAGGGCCGCCT CGGCCNNNTGNNNACNNNATNNNG CNNNTGNNNACNNNGGCCGTAATG GCCGGTACCTTA , Sangon Biotech.

Techniques: Amplification, Purification, Control, In Vitro, Reverse Transcription